T
Taj For Doctors
Taj For DoctorsTaj Doctor
home

About Us

Taj Brands

Diseases Health Tips  HIV/AIDS News Contact Us

 
flick left flick upper right
menu upper

  All News
  Allergy
  Asthma
  Cardiology
  Clinical Research
  Critical Care
  Dentistry
  Dermatology
  Endocrinology
  Gastroenterology
  General
  Genetics / Biotech
  Men's Health
  Infectious Diseases
  Fitness/Lifestyle
  Nephrology
  Neurology
  Oncology/Haematology
  Ophthalmology
  Orthopaedics
  Otolaryngology
  Paediatrics
  Psychiatry
  Reproductive Health
  Respiratory Medicine
  Surgery
  Sex
  Urology
  Women's Health
menu lower
Genetics / Biotech back
Genetics: the study of biological heredity and variance. In simpler terms, it's the study of how genes are passed from parent to offspring, and how those genes create certain characteristics in an organism. Genetics is a term that is relevant to all biotechnology; it is a biological area that studies how genes are inherited, and what they do. Genetics forms the base for all biotechnology, and in-fact, life itself. All life on the planet is made up of DNA and genes; DNA provides the genetic make-up for a being.
The modern age of genetics began in the early 1800s when Jean Baptiste Lamarck (1744-1829) suggested that animals passed on acquired traits. This means that Lamarck believed that a baby giraffe's neck was long because its parents stretched their necks as they tried to graze on the leaves of tall trees. However, we now know his hypothesis was false. For example, if a man loses his right leg in a car accident, we don't expect his child to be born missing a right leg. Modern biology has since grown by leaps and bounds as scientists strive to understand genetics and DNA by studying bacteria, viruses, mice, plants, and thousands of other organisms. In 1988, a committee of representatives from the National Institutes of Health and the Department of Energy began to develop a five year plan to construct a physical map of the human genome. In 1990 the Human Genome Project was born and has since grown to include France, Britain, Japan and other countries. It is now widely coordinated by the Human Genome Organization (HUGO). HUGO is a private organization exclusively devoted to coordinating worldwide genome mapping and sequencing and to fostering collaboration between researchers.
Introduction to Genetics

Basics of Genetics


Pharmaceuticals companie's genetic research efforts will help change the way medicines are discovered, developed, and prescribed and the way many diseases are diagnosed and treated.
GSK is an industry leader in the field of genetics, focusing on the examination of the genetic basis of common diseases and patients' responses to medicines learning about the identity and function of genes associated with diseases and understanding why some medicines work better for certain people than others and who is most likely to experience a serious side effect.
 

DNA
How do cells know what to do in your body? How can DNA determine what you will look like?

 

Instructions that provide almost all of the information necessary for a living organism to grow and function are in the nucleus of every cell. These instructions tell the cell what role it will play in your body. The instructions are in the form of a molecule called deoxyribonucleic acid, or DNA.

DNA is the chemical responsible for preserving, copying and transmitting information within cells and from generation to generation.

In humans, the DNA molecule consists of two ribbon-like strands that wrap around each other, resembling a twisted ladder. This is often described as a double helix. DNA is contained in tightly coiled packets called chromosomes, found in the nucleus of every cell. Chromosomes consist of the double helix of DNA wrapped around proteins.

The twisted ladder is made up of repeating units called nucleotides, each of which is a single building block of DNA. Nucleotides are composed of one sugar-phosphate molecule (the linear strands or outer rails of the ladder) and one base. DNA consists of two nucleotide strands joined by weak chemical bonds between the two bases, forming base pairs. A base pair is a rung or step on the ladder of the DNA. The bases are called A (for adenine), C (for cytosine), T (for thymine) and G for guanine.

These bases always pair up in the following way:

A+T
C+G

A single strand of DNA is made of letters:
ATGCTCGAATAAATGTGAATTTGA

The letters make words:
ATG CTC GAA TAA ATG TGA ATT TGA

The words make sentences:
<ATG CTC GAA TAA> <ATG TGA ATT TGA>

These "sentences" are called genes. Genes tell the cell to make other molecules called proteins. Proteins are required for the structure, function, and regulation of the body's cells, tissues, and organs.

We have approximately three billion base pairs (6 billion bases total) of DNA in most of our cells. This complete set of genes is called a genome. With the exception of identical twins, the sequence of the bases is different for everyone, which makes each of us unique.
DNA and Human Diversity

Although we all look quite different from one another, we are surprisingly alike at the DNA level. The DNA of most people is 99.9 percent the same.

Only about 3 million base pairs are responsible for the differences among us which is only one tenth of 1% of our DNA. Yet these DNA base sequence variations influence most of our physical differences and many of our other characteristics, as well.

Sequence variations occur in our genes, and the resulting different forms of the same gene are called alleles. People can have two identical or two different alleles for a particular gene.
Mutations

A mutation or polymorphism is a change in the DNA "letters" of a gene or an alteration in the chromosomes.

Polymorphisms are common differences in the sequence of DNA, occurring in at least 1% of the population. Mutations are less common differences, occurring in less than 1% of the population.

What is a mutation in one place may be a polymorphism in another. For example, the base change that causes sickle cell anemia is defined as a mutation in Caucasian populations because it occurs in less than 1% of people. In parts of Africa where it is found in 25% of the population, it is defined as a polymorphism.

Most DNA variation is neutral (not beneficial or harmful), but harmful sequence changes sometimes do occur. Changes within genes can result in proteins that don't work normally or don't work at all. Some of these changes can contribute to disease or affect how someone responds to a medicine.

Mutations may be passed down from parent to child (in the sperm or egg cells), may occur around the time of conception or may be acquired during a person's lifetime.

Mutations can arise spontaneously during normal cell functions, such as when a cell divides, or in response to environmental factors such as toxins, radiation, hormones, and even diet.

Nature provides us with a system of finely tuned repair enzymes that find and fix most DNA errors. But as our bodies change in response to age, illness and other factors, our repair systems may become less efficient. Uncorrected mutations can accumulate, resulting in diseases such as cancer.
Genes

Genes are the basic units of heredity in living cells. They consist of a length of DNA that contains instructions ("codes") for making a specific protein.

Through these proteins, our genes influence almost everything about us, including how tall we will be, how we process foods, and how we respond to infections and medicines.

Although most of our cells have the same genes, not all genes are active in every cell. Heart cells synthesize proteins required for that organ's structure and function; liver cells make liver proteins, and so on. In other words, not all the genes are "switched on" and expressed as proteins within every cell. Within an individual cell, the same genes may be switched on at some times and switched off at other times.
Disclaimer - The contents of this site are for informational purposes only. Always seek the advice of a qualified physician for any doubts. 
flick flick right
 
 

         Copyright 2004- 2006 TAJ Pharmaceuticals Limited. All Rights Reserved.

Site Requirements : Internet Explorer 5.0+ or Netscape 5.0+, Flash Player 5.0 & Real Player 8 Basic
To get in touch with us, call on 91-22-2637 4592, 91--22-2637 4593 or fax us at 91-22-2634 1274 

Terms and Conditions | Disclaimer | Privacy Policy | Sitemap | Feedback | FAQ